EXCLUSIVA: FABRIZIO VILALLONGA DENUNCIADO




¿Y POR QUÉ HA SIDO DENUNCIADO?


Por no pagar un encargo.

Fabrizio es conocido en la prensa del corazón por ser hijo adoptivo del desaparecido escritor José Luis de Vilallonga e hijo biológico de la segunda mujer de éste, Syliane Stella. De hecho, se benefició de la popularidad de sus padres para vender su boda, una boda absurda en Ibiza con Lucía Montojo, la autora del libro "El callejón de la muerte" y a quien me gusta leer semanalmente en La Razón, ya que sus entrevistas son amenas y distintas, como ella misma.

Syliane, una mujer que a pesar de haber estado casada con un millonario y luego con José Luis de Vilallonga, siempre ha sido muy trabajadora y una gran relaciones públicas. Es muy raro que alguien hable mal de ella, ha tenido sus negocios relacionados con la hostelería y han funcionado porque ella ha estado al pie del cañon, cada día y cada noche. Cuando se separó, se fue a vivir a Palma de Malllorca y durante un tiempo vivió con su hijo Fabrizio. Pero él apoyó a su ex marido y se fue de la isla. Sé que hubo un problema gordo entre madre e hijo que ella nunca ha querido desvelar porque le quiere, pero durante muchos años, Fabrizio estuvo sin hablar a su madre cuando fue él quien no sé portó nada bien con ella.

Una vez que se separó de Lucía Montojo, se enamoró de Cristina Frontera y se instalaron en Palma. Actualmente, tienen dos negocios en la ciudad: la discoteca “Art Deco” y el restaurante "Variadito". Muchos comentarios me han llegado sobre cómo actúan y se comportan ambos con los empleados, pero por fin tengo pruebas, la denuncia que muestro abajo. Lo hago porque Carlos Alberto Di Croce es un trabajador que se gana legalmente la vida con su trabajo y según cuenta en la denuncia, no sólo Fabrizio Pastor (como se llama realmente) no le paga, sino que además fue presuntamente intimidado por tres hombres que trabajan para él.

Carlos, el denunciante, declara que fue contratado por Cristina Frontera para hacer unas tarjetas gráficas para los dos negocios. La factura asciende a 1.700 euros, los cuales no pagaron. Al no ponerse en contacto con él, Carlos se presentó en el restaurante y Fabrizio le dio una pequeña cantidad para callarle la boca. A los dos meses acudió de nuevo, pero esta vez a la discoteca con la intención de reclamar su dinero. Al ver que no le pagaban, Carlos dijo que pegaría fuego al local. Fabrizio se asustó y le puso en contacto con su administrador, con el que quedó en el restaurante “Capuccino”. Una vez allí, Carlos recibió una llamada. Le dijeron que saliese del restaurante y que se subiera a un coche en el que se encontraban tres individuos (Julio, El Cubano y El Rumano), según el denunciante. Uno de ellos, Julio, le dijo: "A nosotros nos ha mandado darte una paliza Sebastián (el administrador), pero como tú eres un trabajador no te vamos a hacer nada, pero te advertimos de que no vayas a molestar ni a la discoteca, ni al restaurante, si no te tendremos que pegar porque a nosotros nos pagan para esto, pero es poco dinero y no te vamos a hacer nada, pero no sigas reclamando el dinero”.

Ya lo he dicho al principio, me habían llamado en muchas ocasiones para decirme cómo actúa Fabrizio en Palma y qué medios utiliza con sus trabajadores, pero hasta que no he tenido en mis manos esta denuncia, no he querido contarlo. Ahora tendrá que ser un Juez el que averigüe si todo esto es cierto, pero Carlos está desesperado por no cobrar.
.
.
.
Denuncias (click para ampliar imágenes)






.
.
.
.
.
.
.
Foto 1: José Luis de Vilallonga
Foto 2: Syliane Stella
Fotos 3, 4 y 5: Denuncia

Lydia Lozano

779 comentarios:

«El más antiguo   ‹Más antiguo   1 – 200 de 779   Más reciente›   El más reciente»
Anabel dijo...

Hola lidia acabo de ser seguidora de tu blog y me encanta poder leerte, eres una persona que a luchado mucho y muy duro y mereces toda mi admiración y cariño, te sigo todos los días en la tele y me encanta como vives cada situación como si fuese tuya.
Te cococí en tómbola y desde entonces te he admirado.
Habrá veces que te equivoques, habra otras que no pero siempre desde tu verdad sigue así no cambiaes nunca.
Un beso enorme cuidate

Laura_Tala dijo...

Ole Lydiaaa eres la mejor, otra exclusiva mas y encima demostrada como siempre.
Eres una gran periodista y solo hay k verlo, sigue asi wapisima, k te mereces todo lo mejor.

Sobre la exclusiva, es normal k el denunciante pida su dinero, xk se lo gana y es suyo. Es penoso k los grandes tengan amenazados a los pekeños. ojala el hombre cobre lo k es suyo. pero como dices tu lydia k sea un juez el k lo averigue.

1besazo y enhorabuena

..Carles.. dijo...

Hola Lidia, hace años que te sigo, desde que trabajábas en Tómbola, y me encantas!!
Me gustaria que actualizaras más a menudo el blog, ya que es muy interesante todo lo que cuentas.
Te mando muchisimos besos y un fuerte abrazo!
* Podrias mandarle un saludin a tus compis de sálvame de mi parte???
Muchisimas gracias wapa. besos!

sara dijo...

Lydiaaaaa!

Que fuerte me parece todo, primero me a impactado lo de que no le pague todo y solo una parte y como tu dices para callarle la boca, pero esque peor me parece que lo amenazen con pegarle por reclamar su dinero ¿Que són niños de 15 años?. No lo veo normal y encima pagarle por ello anda hombre!

Lo que me parece genial es que lo haya denunciado pues yo también lo haría.

También me parece genial que te esperaras a contar la noticia hasta que no tuvieras las denuncias (aunque a mi no me hacen falta pruebas para creerte sinceramente).

Un besito muy grande.
Tequiero!

Sestefanya simepre Lozanista dijo...

Lydiaa
Que fuerte me parece todo,lo de que no le pague todo y solo una parte y como tu dices para callarle la boca que fuerte yo a lucino
besitos para todos

Anónimo dijo...

hoy los invitados de sálvame son
Rosa Benito ,Kiko Belén ;Lydia y el otro no e quine es y a mila no la vi asin que no se si entara solo vi a esa ente espea ahora no se si la que vi es lydia o mila bueno que he son la gente que van
Lucia

Antonio dijo...

muchas gracias por informarnos Lucia!!

Maria09 dijo...

Un poco fuertee!
Desde luuego..

moniilandiia dijo...

dios! que fuerte,Lydia.
Me parece genial que denunciara,cualquiera en su lugarlo haría,vamos...como para no hacerlo!


tus posts valen oro!
un beso

¡QUE FUEEEEEEEEEEEERRRRRRRRRTE! dijo...

ESTE BLOG TIENE UN NIVELON K TE CAGASSSSSSSSS
¡¡¡¡¡¡K FUERTEEEEEEEEEEEE LYDIA!!!!!
¡¡¡¡¡¡¡K BIEN LO HACES LYDIA!!!!!!!!
¡¡¡¡¡¡¡¡¡K INFORMADA ESTAS LYDIA!!!!!!!!!

VAYA PANDA D PALMERAS VISITAN EL BLOG

Miska dijo...

Holaa! Yo me pregunto como consigues saber todas estas cosas, jajaja. Pues la verdad es que me parece bien que este señor haya denunciado. Es increíble que hayan pagado a esos señores para que le peguen, pero por lo menos no lo hicieron... Es normal que reclame su dinero, si es SUYO, por favor!
Muchas gracias a Lydia por mantenernos informados a todas horas, tanto en Sálvame como aquí, y siempre tener exclusivas con sus pruebas correspondientes. Un beso!

clara dijo...

hoy me a gustado muxo salvaameee :)
jejeje a y lydia estabas muy guapaa
bessitooos a todos los lozaistaas y
a ti LYDIIA!

PD: ahora comento con el nombre de clara2
pk hay otra clara, y para o liaroos
jaajajjaajja =)
xaaaaaaaao

Antonio dijo...

que guapa ibas hoy lydia!!!!!!!!! aunque alguno me llame palmero te digo la verdad y punto! :D

Anónimo dijo...

¿Qué ex-concursantes de GH 11 irán pronto a DEC? recordemos que de tod@s l@s concursantes de GH 10, sólo la chiqui fué de invitada al programa de Cantizano.

LYDIA LOZANO dijo...

Bueno, no tengo ni idea, de quien puede ser de GH11, dinosló. Pero para fuerte lo de la Campa y Jesulín que han rodado la vida del feliz matrimonio en Ambiciones, jajaja donde no viven, va al programa de Juan Imedio, y creo que por todo ha cobrado nada menos que 30.OOO eurazos. Creo que todo es maravilloso para que Antena 3 les tarten bien, yo creo qe de cara al juicio. También tiene una entrevista firnmadacon Espejo Público. Se sentará en la sección de la alfombra roja? Hablará del Caso Carlos? Dirá por qué está en Madrid grabando y no va a ver a Andreíta?.....Esto es el mundo al revés

LYDIA LOZANO dijo...

Perdónnnn!!!! Siempre me pasa lo mismo jajaja. He confundido los euros con pesetas! En el mensaje que acabo de escribir me refiero a "30 MILLONES DE PESETAS". Ya os seguiré contando porque es un tema muy interesante y tiene mucha chicha. Mil besosssss

sara dijo...

De verdad que si que és el mundo al revés. En Espejo público hablará de todo, lo mas seguro.
Y bueno eso del matrimonio feliz yo creo que andie se lo a creido nunca. Es más yo no sé como Jesulín puede permitir como se porta la Campanario, directamente no se como la aguanta, pero vamos que él se está volviendo como ella creo yo.

Que fuerte todo.

Lydia yo quiero preguntarte una cosa. ¿Crees que Campanario irá a la cárcel?
Yo creo sinceramente que no, aunque no me pareceria justo.

Un besiito grande grande tequiero!

Anónimo dijo...

Hola!!! Rosa benenito vive en madrid o en sevilla??

Anónimo dijo...

Lydia!! Tu marido en salvame diario y deluxe o pasa de este tipo de programas??

Anónimo dijo...

Preguntas para Lydia:

¿en qué página o páginas web se pueden ver las fotos de Contreritas con el torso al aire que se vieron en el último DEC? ¿qué te parecen?

¿no sabes todavía cuando terminará GH 11?

Laia dijo...

hola Lydia gracias por informarnos de lo qe pasa en España, y decirte que eres la caña y que cuando esta tu en sálvame se nota pq eres la q aportas diversión y q yo pr lo menos me ría jeje besos q vaya bién, por cierto una pregunta: ¿quién es la pareja de Mila?, es alguien conozido¿?¿ adéu (adiós)

Marhy dijo...

Y para variar...nos das otra gran exclusiva en el blog!!! Que fuerte me parece lo de este hombre, no pagarle a alguien por un trabajo que le ha hecho para sus negocios, si no quieres pagar no mandes hacer nada, mucho menos se puede ser tan mala persona y callarle la boca de ese manera...que aprenda un poco de la humildad que tiene su madre, no?

Lo de Jesulin, no puedo con él jajajjajaja me parece fatal que ahora nos venda un especial de su feliz vida, y opino que si pisa Madrid lo primero que debia hacer es ver a su hija, a que está esperando? a q esa niña sea mayor y decida no querer verlo, anda que ya se nota el tipo de gente q es...q prefiere venir corriendo por 30 millones de pesetas, en vez de por ver a su hija? indignanteeeee me parece!!!
jajajjaja parece ser que Antena3 nos tiene preparadas grandes entrevistas! jajaja como saben que competir con el deluxe es tarea dificil!!!

Hoy que has dicho lo de Pepa Flores, hubo un momento del especial en que tambien Mª Teresa Campos dijo algo de que no se enfadara su amigo Eusebio con ella, por poner esos videos, asi que si lo dice será porque los mando él. De paso he de decir que Pepa, como persona me encanta, apartada de todo, tal y como siempre quiso, y asi está siendo, es un respeto tanto de ella como de los medios hacia ella, porque se lo merece y personas como ella son dignas de admirar!!!!

Un besazo a todos, te quiero Lydia!!

Alicia dijo...

Sara yo también pienso que lo de matrimonio feliz no es nada creible.
Por favor si todavía tengo en la retina esas imágenes de hace años en las que se veía a la Campa y Jesulín en una piscina, ella intentando captar la atención de él, echándole los brazos por encima y tal y él como que pasaba e iba a su aire; y eso por no hablar de las imágenes de este verano en la playa, vamos sus rostros eran el vivo reflejo de la felicidad, derrochaban alegría a raudales, es que se notaba que se lo estaban pasando bomba... jajajajaja
Viendo esas imágenes de sus vacaciones es imposible pensar que no son felices! (hoy me ha salido la vena irónica)
y que le paguen 30 millones de pesetas por eso!
En vez de contar sus felices vidas deberían de hablar sobre el caso Carlos que es lo que nos interesa a todos.
y qué clase de padre es ese que va a Madrid y no va a visitar a su hija después de tantos meses sin verla?
es que claro, luego la Esteban se queja pero con razón!

Y sobre la exclusiva de Fabrizio me parece fatal que no le pague lo que le debe a este chico, pero peor me parece que mande a que le peguen por haber reclamado lo que es suyo.


Un besito.

Anónimo dijo...

Me parece muy fuerte lo de este Fabrizio, que ande por la vida de esa forma. Se debe pensar que es Dios, junto con su mujer, haciendo y desasiendo a su antojo. Como puede una persona mandar a pegarle a un hombre por reclamar lo que es suyo. He entrado en un buscador y eh leído sobre este Fabrizio, parece que es un tio de cuidado. Tiene en el juzgado causas por la compra de ArtDeco, ya que estafó a sus socios este verano. Para mí que eso de estar con Villalonga fue por puro interes ecónomico.
Valla canallas que hay en esta vida..
Saludos

Maria dijo...

Acabo de entrar en el google y puse Fabrizio Pastor, por dios valla tela, dejó a su padre verdadero para irse con el Señor Villalonga, su padre real es italiano y tiene fortuna, con razon que este hijo le halla salido un vago, si no debe saber lo que es el curro!! Ni ganarse una pela.
Escriben que fué el culpable de la separación de Stella con Villalonga, que vendió una boda en exclusiva...Y dice además de esa Cristina que sus padres son adinerados, me pregunto porque no le pagan a ese hombre, ó son los nuevos chorizos de guantes blancos eh ??

Sestefanya simepre Lozanista dijo...

Hola tienes razón Lydia , pero vamos que le han pagado bien para que hable pero seguro que de lo que mas interesa ni hablara y saldrá pro la tangente pero bueno.
Besiitoss

Anónimo dijo...

hoy estran Lydia,Rosa,Belén y Kiko son por ahora los unico que he vsito
Lucia

Jenny.M dijo...

Sobre la noticia, me parece muy bien que el señor halla denunciado.
Y me parece, como dijo Sara, que nadie, nunca se ha creido que sean un "matrimonio feliz".

Quien pudiera saber tantas cosas como las que sabes tu Lydia!!!

Un besazo enorme!!
Y nunca dejes de ir a Sálvame porque aportas MUCHÍSIMO al programa!! :)

sara dijo...

Alicia pero a mi lo que me parece muy fuerte, es que después de las imagenes de la playa que se han visto este verano, sigue diciendo intentando hacer ver que está bien su matrimonio.
Y bueno lo de que clase de padre és, no hay palabra en el diccionario que sirva para definirlo, me parece vergonzoso que vaya a Madrid y no pase a ver a su hija, cuando lo que tendria que tener es ganas de verla.
Estoy de acuerdo contigo también en lo de Belén. Y quién no en su situació no se quejaria?

Un besazo Lydia(L)

Anónimo dijo...

pido perdon pro unas con fusiones pero es que yo no conosco a est gente y siempre me ocn fudo pero ya se que es Rosa Benio y qui e sMila y Lydia la prosima vez ops prometo que no em confundire besitos
lucia

Anónimo dijo...

Lucía, trabajas en T5 ?? Esque como dices por lo que yo he visto...

Anónimo dijo...

La cosa importante de belén es que esta embarazada!!

Anónimo dijo...

tu sara que estas diciendo??? pues claro que ha ido a verla joder!! esque os inventais las cosas de una manera... fuuuass!! menos mal que no estais en el mundo del famoseo porque si no...

sara dijo...

Perdona yo no me invento nada, de eso nos hemos enterado a las 6 y pico de la tarde y si miras mi comentario está escrito a las 15:05.

Anónimo dijo...

ya por eso, que no juzgues a las personas sin tener pruebas coño! que luego pasa lo que pasaa

Jose dijo...

Que el Fabrizio page, soy de Mallorca y es un estafador este tio. Y su clan.

Alicia dijo...

Anónimo y que hay que darle un premio por haber ido hoy a verla después de 6 meses?

sara dijo...

pues entonces no digas que me invento las cosas! Y dejo el tema no estoy aqui para discutir con nadie.

Estoy aqui para apoyar a Lydia y opinar.

sara dijo...

Si Alicia esque a los hijos se les tiene que ir a ver cada 6 meses.
Madre mia.

anonimo pasajer@ dijo...

LYDIA ESTO DEGENERA CADA VEZ MAS.......
AQUI HA ENTRADO LA GRIPE A B C D .........
HA PERDIDO GLAMOUR..........
¿DONDE ESTA TU GENTE DE ANTES?

(alguien descolocad@)

Anónimo dijo...

que crias soys no?? iros al confe de kiko que hay eso es un chat autentico jajaja

moniilandiia dijo...

la campa tiene una cara que se la pisa...
se le devería caer la cara de vergüenza,pero al parecer su familia es igual que ella.

LA LOZANO ESTA RESENTIDA dijo...

LIDIA LOZANO CON LOS COMENTARIOS QUE HACES DE JESULIN Y CAMPANARIO, DEMUESTRAS LO HOTERA Y CUTRE QUE ERES, Y ADEMAS UNA RESENTIDA, SEGURO QUE TE GUSTARIA HACERLE LA ENTREVISTA A TI, PERO DE ESO NADA MONADA, LA VERAS Y NO LA CATARAS JA,JA,JA, Y HA LA KAKA DE LA BEEEEE... QUE SE VAYA A LA MIEEEERDDDAAAAA.

SARIMA dijo...

Vuelvo a ser la nota discordante una vez más, querida LYDIA. Te explicaré porqué.
Intento comprender las razones del porqué de tanto odio a la Campanario y porque esa sobreprotección a Belén y....... sinceramente, no las entiendo.
Entiendo que en el mundo del famoseo hay "GENTE QUE CAE BIEN Y GENTE QUE CAE MAL" , esto lo tengo claro , porque hasta yo misma desde el sofá de mi casa, puedo llegar a sentir cierto cariño hacia algún personaje y al mismo tiempo rechazo por otros.
Pero vamos a intentar ir más allá .
-Que la vida de Jesulín dió un giro desde que se casó , es obvio que sí , pero como cambia la vida de cualquier persona.
-Que su mujer pudo heberle cambiado un poco , ¡puede!
Pero entonces .....¿él no tiene personalidad?, ¿acaso es un títere en manos de ella? ,pero aparentemente un títere feliz ,por mucho que os esforceis en mostrar su infelicidad.
Yo no se cómo veis a Belén , pero caracter tiene y mucho y lo demuestra , entonces sí Jesús es tan "tonto" que se le puede manipular , yo me pregunto ¿cómo es que ella no lo manejó a su antojo? No es más fácil pensar que simplemente esta chica no le llenó lo suficiente , por eso no luchó por ella. Y que ahora simplemente llegó a su vida una persona que lo ha sabido comprender y que se entienden y por ello intentan ser felices , incluso sorteando muchos obstáculos que le ponen en el camino.

Ahora otro capítulo en la vida de ellos, la presunta estafa que quiso hacer a la SS la Campanario. Ahí quiero decir que espero que se celebre un juicio justo y sin ningún tipo de miramiento y aportando todas las pruebas de su presunto delito y de su madre si tambien está en ello ,como cualquier otro.
Con esto sí que no tengo consideraciones con nadie , el-la que sea un ladrón-ona que lo pague y caro. ¡A LA CÁRCEL!

Y el capítulo donde ya participa la Esteban , este sí que hay que cogerlo con cuidado.
Explico lo que veo yo.
Una mujer que se enamoró de un señor cuya profesión es torero , o sea hay dinero.
Existe un tiempo de "amor" , pero este se acaba y queda algo maravilloso que es una hija.
Hasta aquí normal , como cualquiera de la calle.
Y así empieza una guerra sin cuartel , de una señora despechada que no soporta que otra mujer forme parte de la vida del que ,hasta hacía un tiempo , se pensaba que volvería con ella.

Un buen día alguien la contrata en la tele , y poco a poco se va tejiendo una espiral acerca de su vida , de la que ella no es muy consciente , pero pronto aprendió y se dijo así misma "soy un filón" y voy a vivir de los Janeiro y familia hasta que ........
bueno el final todavía está por llegar, ya veremos cómo acaba.
Tambien voy a repartir "leña" con él , no se va a ír de rositas.
Que no está demostrando ser un buen padre con esta niña , ¡¡pues no!!!!, pero que no hay una persona más que él , en el mundo ,que aguante ver y oir cómo la madre de su hija, va radiando día tras día la vida de su familia , esto a mi me parece muy cruel.
Seguramente sea su hija la que se encargue de decirle en su momento , que la faceta de padre con ella no la ejerció nada bien y tomará sus medidas y ese será su castigo , ¡el peor!.

Tambien es cierto que sus actos siempre son juzgados , le anlizan cada movimiento que hace .
-Sí viene porque viene , si no vino porque no vino.
-Que si hace reportajes con sus otros hijos , y a ella que le importa ,¡vamos digo yo! , ella hace lo que quiere y en Ambiciones nadie lo va contando a las televisiones , es más creo que la temen.

Cuando algún día se pare , reflexione y repare en el circo en que ha convertido su vida , igual cambia , y en ese momento la vida se encargará de ponerla en su sitio.
En otra ocasión dije que esta chica está mal , ha perdido el norte hace tiempo y en su cabeza sólo ve focos , gente vitoreando ¡arriba la Esteban! , incluso algún compañero que le hace creer que vale mucho para la tele , enfín demasiado engaño a su alrededor.

Despues de todo esto , intento aportar otra forma de ver esta película.

MILES DE BESINES Y CARIÑOS

Miska dijo...

Hoy no pude ver Sálvame :S Mañana ya me enteraré de todo jajajaja.
Por cierto, Lydia de hortera no tiene UN PELO.

Rocio dijo...

Sarima, estoy en muchas de las cosas que has comentado de acuerdo contigo. Yo precisamente no soy de las que digo ¡¡¡arriba la esteban!!! Porque me parece que es una persona como otra cualquiera que según mi punto de vista aveces actúa bien y otras mal y por tanto no voy a estar defendiendola a capa y espada por mucha belén y mucha esteban que sea.
Me gustaría destacar el principio de la "historia" jjajja que has contado de ella. Si no me equívoco se caso con un torero y podemos decir que se hizo famosa. Entonces ahora yo te digo, si no es periodista y por lo que veo en salvame, se documenta poco de los temas que tratan DE QUE VA A HABLAR?? pues de jesulin que es realmente el porque esta ahí y como tienen que hablar de el pues buscan el mínimo detalle.

Con este comentario no quiero decir que este de parte de la campanario porque esa también tiene lo suyo, pero de ello comentaré en otra ocasión. Pero si que me gustaría resaltar, como he dicho antes, que belén es persona y hay veces que se equivoca, como yo y me imagino que como todos y que no es bueno lo que hace mucha gente en decirla en todo momento arriba la esteban porque así nunca podrá reconocer sus errores. Y ya os digo yo, que de esa manera no la estáis ayudando.

Espero que mi opinión no ofenda a nadie.

Un besito

Anónimo dijo...

hola, sarima de acuerdo contigo en todo.

hoy no he visto salvame ni ayer, no lo he grabado tampoco, pero he visto en la web de tele5 la declaracion nueva de belen, ¡¡otra vez¡¡ no queda nada para la intimidad por lo que se ve.

y hoy despues de mucho tiempo he puesto un rato la tele para ver lo que se comentaba de gh, ¡¡ cuanto hecho de menos el corrillo del principio de la campos¡¡¡ que risas¡¡¡ ahi me aficione yo a dia a dia, bueno al corrillo y al debate politico, los sucesos no les veia, ya tenemos bastantes con los telediarios y los periodicos.

bueno que me he puesto a ver los comentarios y no puedo con ansosa¡¡¡ cada vez mas cursi¡¡¡ y he apagado la tele.

besos de maria.

Anónimo dijo...

soy mariua otra vez.

he querido decir que he encendido la tele por la mañana despues de mucho tiempo, es que normalmente no la enciendo, pongo la radio.

Anónimo dijo...

El especial de las 36 horas de Jesulín se emitirá el próximo lunes a las 10 de la noche en Antena 3. Dicho especial tendrá de competencia a Risto y los CSIES en Telecinco, al hijo de Sancho Gracia y su serie en TVE-1, y en Andalucía al Quintero y sus Ratones Coloraos. El pasado lunes, Malena Gracia cantó en TV Canaria, y lo repetirán el próximo domingo a las 4 de la tarde (hora peninsular) en la version satelital de dicha TV pública regional.

clara2 dijo...

hoy estara lydiia en salvamee?
aaah i porcierto ayer me gusto muxo
el salvame me rei muxxissimooo :)
jejejee
besiiiiiiiiiitooooooooos a todos
los LOZANISTAS y ati LYDIA.

Antonio dijo...

lydia, siendo serios y objetivos, Jesulin tiene derecho a defenderse de todas las acusaciones que la ha hecho la populista de Belen Esteban. Ella habla todas las tardes de su hija y del padre de ésta, y ahora el no puede ir a un programa de TV a contar su historia?

Marta dijo...

Fabrizio Pastor se muda a Miami con sus "negocios" y sus cubanos matones...en diciembre se corre el rumor por Mallorca. Esperemos que no deje a tanta gente sin su dinero este hombre.

Anónimo dijo...

Lidia, me gustaria que le trasladaras esta reflexión a Belen:
Que casualidad!!!! el lunes 26 de octubre Jesulín va a ver a su hija despúes de seis meses y el Lunes 1 de Noviembre SUPER ENTREVISTA EN ANTENA 3 " 36 HORAS CON JESUS Y LA CAMPA"
Lidia no se que pensarás, pero yo no creo en las casualidades.
un saludo. sonia

Anónimo dijo...

si en un programa de telecinco
Lucia

AL SEÑOR JESULIN DE UBRIQUE dijo...

ESTOY DESEANDO VER A CAMPANARIO Y JESULIN, DESDE AQUI TODO MI CARIÑO Y APOYO POR LOS MALOS TRATOS Y ACOSO TELEVISIVO DE LOS QUE HAN SIDO OBJETO, ESTA PAREJA QUE TAMBIEN SON PADRES Y SUS NIÑOS SIENTEN COMENTARIOS POR LOS COMENTARIOS DE ESA ESTUPIDA DESEQUILIBRADA QUE SOLO PIENSA Y VIVE POR JESULIN.

CONTINUA... dijo...

SI OS DAIS CUENTA YA HAY MUCHA GENTE QUE ODIA Y RECHAZA A LA EX DE JESULIN ' LA OTRA ' CREO QUE ELLA SOLITA SE LO ESTA BUSCANDO POR ' MALA ' SEÑORA B.E. VAYASE USTED A LA MIERDA .

ARRIBA JESULIN dijo...

YA ERA HORA, EL QUE RIE EL ULTIMO RIE MEJOR ,QUE EL TIEMPO PONGA A CADA UNO EN SU SITIO, Y YA LO ESTA HACIENDO, ARRIBA JESULIN, LO UNICO QUE NO ME GUSTA ES QUE MATE TOROS, PERO ESO ES APARTE.

Anónimo dijo...

Has cambiado tanto que no eres tú. La pela es la pela. Soy pro Jesulín y Anti Belén. Una mujer si embaraza es porque quiere, y Belén quedó preñada para cazar al torero. Recuerdo muchas cosas que dijiste en tiempos de tómbola y ahora... Hace bién en no ver a Andrea Esteban porque no es nada más que hija biológica, pero al no vivir con él no tiene nada de él. Un hijo es algo más que engendrar por eso se quiere a los adoptados y.... ¡a las mascotas!. El roce hace el cariño, y te recomiendo que te aisles quince días con tu pareja y recapitules quién eras y quién eres. La Lydia de antes era adorable. Carmen

scarlata dijo...

HOLA, acabo de conectarme y como siempre hago , miro el blog de LIDIA, cual es mi sorpresa al leer tantos malos comentarios de belen esteban, creo que la gente ya empezamos ha conocerla y hace que nos apiedemos de JESULIN Y CAMPA, por los ratos que han tenido que tragar,por culpa de esta mujer despechada, me gustaria que hicieramos una campaña de sinceridad y que cada uno diga lo que piensa sobre el trio de b.e. jesus y campa, pero sin falsedades, nos llevariamos una gran sorpresa de lo muchos puntos que ha bajado belen esteban y cuantos ha ganado el matrimonio janeiro, yo me alegro mucho, porque soy de las que odia a la PIRAÑA de SALVAME . Animaros y escribir con el corazon asi LIDIA se dara cuenta de lo equivocada que esta. Un beso guapos.

Anónimo dijo...

por ahora solo e vsito a Belén y A Lydia
lucia

Anónimo dijo...

lucia pero tu donde las ves??

Anónimo dijo...

Que caxonda lucía porque no dices a kiko o karmele??? Porque dice esas dos porque sabe perfectmnte que van a ir xk lo dijern ayer anda anda lucía tía

IGUAL SUENA LA FLAUTA......Y ACIERTO dijo...

EN NINGUN SITIO ESTA LO INVENTA TODO
PENSAIS K VE ALGO?????????
K SANTA LUCIA TE SIGA CONSERVANDO LA VISTA PERO TE RECOMIENDO GRADUACCIÓN

Anónimo dijo...

Lucía, en que programa de telecinco trabajas??? Pero eres de las cámaras o presentadora o que

Anónimo dijo...

Donde van esta noche o que???

Anónimo dijo...

lydia, como te cae paz padilla? es que cuando entró te vi que no pusiste muy buena cara...

Anónimo dijo...

lydia, te has tirado a valentin paredes???

Anónimo dijo...

Anónimo, estoy trabajando y por eso
No puedo ver salvame orquereguntas eso??? Han dicho algo???

sara dijo...

Lydia crees que volveran Techi y Paquirrin?

Un besooo!!!(L)

Anónimo dijo...

saraaaaa, pues no se si tendran una relacion estable pero como dicen en mujeres y hombres tiki y taka segurooo! ¿sabes a lo que me refiero?

moniilandiia dijo...

Lydia me encantó eso de : mañana iré a cenar con Techi.
Obviamente ésta te contará muchas cosas de Kiko,porque desde mi punto de vista es la que más le conoce.Espero que nos informes de los acontesimientos en la esperada cena,una cena que será el primer encuentro,pero Lydia,como buena periodista sácale todo lo que puedas.
Bueno,han cortado Kiko y Techi ¡Qué raro!¿no? en fin...me huele a reconciliación,siempre pasa lo mismo cuando uno es hijo de______.Super exclusiva pero con tantas rupturas hemos llegado a la conclusión de que a Kiko no lo aguanta nadie.
Supongo que Techi hablará con Isabel,y si Isabel se entera de que tú y Techi vais a cenar¿ cómo se lo tomará?

Sobre el tema de Norma.
Norma es una mujer guapísima(tras pasar por el quirófano) y aunque la voz no la acompañe con el físico es muy envidiable.
Creo que te devería quitar las denuncias ya que como media España creemos fueron por peticiones de Frade,y si ya no está con él ¿a qué espera?

Me encanta que Paz presente el próximo Miércoles Sálvame,me parece una mujer:encantadora,simpática y que se sabe ganar al público.

Un besoote!
Lydia informanos sobre esa cena!

LYDIA TE QUIERO!

Mónica

maria dijo...

Es verdad volverán?
Ami si me ha dado la impresion de que paz padilla te cae bien no?? Es genial esa mujeer para los dias que estamos de bajón deberiamos tener cerca a una paz padilla que te hace reir a más no poder

lydia eres la mejor

sara dijo...

Anónimo si se a lo que te refieres.

sara dijo...

Sobre las denuncias de Norma, rezaremos todos para que te las retire :)!

Un besazo(L)

Anónimo dijo...

que mas te da, sara si tu no las vas a pagar???

SARIMA dijo...

--- TITULAR---

" LYDIA LOZANO CENARÁ MAÑANA CON TECHI"

¡EXCLUSIVA! ¡EXCLUSIVA! ¡EXCLUSIVA!

Ultimátum de Kiko a Techi:

"Si cenas mañana con LYDIA, lo nuestro se acabará para siempre"
(ja jajja jajja ajajja me parto y me mondo)

Chica LYDIA , cómo te lo montas.
¡No me lo puedo creer!

A ver cuenta , cuenta y dínos dónde está el truco. O sea vas a ír con Techi , la novia de KIKO , a su vez hijo de Isabel Pantoja , esta última amiga intimíiiiisima tuya...............
¡QUÉ IRONÍAS TIENE LA VIDA!

Bueno , pues sólo me resta decirte que en tú conciencia quedará la ruptura ya "TOTAL" de esta pareja, porque un buen hijo de su madre no puede permitir que su "novia" cene con una señora que no tiene ningún afecto hacia su madre.

Acabo y aclaro que en mi último comentario he desplegado todo mi sentido del humor y he utilizado mi ironía.
Esto no se debería ni tener que explicar , pero es que aquí hay gente que tiene la susceptibilidad a flor de piel y yo no quiero ser la causa de ningún resquemor , esa no es mi guerra.

Lydia , que tú compañera de cena te de buenas nuevas y compartelas con nosotros cuanto antes.

Besines endulzados con sidra.

¡Por favor! se me olvidaba un pequeño "chisme" sobre Techi.
Esta primavera hizo un viaje a Punta Cana , (patrocinado por un Ron , creo, me informaré mejor), en el que iba mí sobrina y a la vuelta mi sobri me contó que se ligó y tiró (palabras textuales de ella) al tío más guapo que había en la playa, y que ya mostraba unos aires un poquito de superioridad con el resto de las féminas .

Claro, la avalaba su relación con Kiko R.P , su gran carta de presentación al mundo de la farandula.
¡CÓMO ESTÁ EL PATIO!

chao

Anónimo dijo...

lydia, tranquila que te las quita fijo PORQUE SON 16!! alguna perdera y ahora no le viene bien soltar un duro guapaaaaaaaa
tu no te preocupeeeees!

Miska dijo...

Cena con Techi? Es que sólo pude ver un trozo de Sálvame! Nos harás un post, no Lydia? ;)
Por cierto, Paz Padilla muy graciosa hoy en el programa jajaj.
Un besoo

clara2 dijo...

me a encantado paaz padilla! jajaja
es muuy graciosaa
aa i k te veia bn la cena con TECHI
xxxxxxxxxxxxxxd :)
bessitoooos (L)

B.E. VAYASE USTED A LA MIERDA dijo...

LA BEEEEE... HOY ESTABA POSEIDA DE ENVIDIA , DE VER QUE LA GENTE QUIERE A PAZ PADILLA Y A ELLA APENAS LE APLAUDEN COMO ANTES , PUES QUE SE JODA POR MALEFICA ,QUE YA NADIE LE PUEDE VER, Y LO BUENO ES QUE SE ESTA DANDO CUENTA Y J.J. TAMBIEN,Y PELIGRA LA AUDIENCIA POR CULPA DE ESTA ESTUPIDA ANALFABETA.

anonimo antibelenesteban. dijo...

de MALEFICA nada , esta por lo menos es SATANICA , que poco le queda a esta tia.

iren moreno dijo...

Hola Lydia:
me podrías decir por qué te ha demandado Norma Duval??
gracias,un beso,tq!

Anónimo dijo...

hola, soy maria.
hoy no he visto salvame.
sobre lo que preguntaba una chica de quien nos cae mejor, belen, campanario, jesulin.

pues no se trata de que unos caigan mejor u otros peor.

belen no es que me caiga mal, me da pena, pero no entiendo que con los años que lleba en la tele y antes incluso,una chica criada en madrid de 35 años no tiene que ser tan chavacana, presumir tanto de su incultura, ser tan borde y creer siempre que esta en posesion de la verdad, no eceptar criticas, o por lo menos pedir explicaciones cuando ella tambien se dedica a criticar, luego y aunque no estoy de acuerdo en todo esto del defensor del menor y la que se ha montado, creo que adtua mal por estar contando y radiando dia a dia, todo lo que concierne a su hija con su padre y abuelos, tios....... y que pensando que su hija es hermana de unos niños, no tenia que tener esa guerra montada con la madre de esos niños desde la tele, pidiendo carcel y lo del cupon y etc, eso no es facilitar la relacion, luego es una inculta de todo, pero se mete en todo, en los juicios hay pruevas que no valen, si son escuchas ilegales creo que no sirven, que deje a la justicia que buena o mala es la que hay y si no nos gusta manifestemonos, o votemos a gente que cambie cosas.

la campa, no me cae bien por su doble cara, si quiere como dice que se la respete y ser la mujer de un torero normal, que no busque el mundo del famoseo, patricia rato es mujer de un torero y sobrina de un exvicepresidente muy conocido, pues ahi esta, no utiliza a la prensa, no gana dinero con ella, ademas en lugar de pacificar con belen, mete sal.

y jesus, porq aun suponiendo que belen sea insoportable y que haya tenido unas relaciones dificiles para tener contadto con su hija, el como tiene dinero y tiempo ya que es su propio jefe y ahora no torea.....si quiere puede, puede venir a madrid aunque sea una vez al mes y tener un dia a solas con su hija, llebarla al parque y a merendar, hasta que la niña desee volver a estar de visita con el.

Exclusiva!!! dijo...

Lydia, y esa exclusiva que tanto has criticado y de la que tanto te has valido para arremeter una vez más contra la Pantoja???. Donde está esa exclusiva que según tú e habia realizado en Moscú durante los conciertos de la cantante??
Donde está Lydia???. MENTIRA, MENTIRA Y MENTIRA!!! Eres pura mentira y a las pruebas me remito.
No hay exclusiva Lydia y una vez más, demuestras el tipo de periodismo que haces.
PUUUUAAAAAAAAGGGGGGGGG!!!!!!

Anónimo dijo...

en Ana Rosa Quintana
Lucia

Anónimo dijo...

hoy esta Kiko y Lydia son los dos que e visto entra por ahora y me andicho que esta no se si es verdad a Karmele y Rosa yo no la e visto me lo an dicho besitos
Lucia

Anónimo dijo...

Y lucía, eres cámara o que

moniilandiia dijo...

respeto señores,respeto
habláis de la Esteban como si fuera el único tema de conversación en el mundo,os pasáis horas y horas hablando de una señora supuestamente ''insignificantes'' para los criticadores.si es así ¿por qué no paráis de darle vuelts a la tortilla?

Y un poco de educación aunque sea la mínima no estaría nada mal,ya que deáis bastante qe desear sinceramente.

Anónimo dijo...

Mónica callaré que tu eresnla pesada que esta yo el día lydia tequiero aaaay lydia!!! Que cansa eres, parece que tienes 8 años aunque igual los tienes de verdad pff

Sestefanya simepre Lozanista dijo...

Anónimo cudadito con lo que dices de Lydia y Monica que por que por Lydia matoooooooooooooooooo y por Moncia tambien matooooooooooooo
orgullo lozanista

Antonio dijo...

no tienes razon lydia!! hay que luchar para que se deje de torturar a los animales! que estamos en pleno siglo XXI joder! antes tambien se metia en la carcel a las mujeres que les ponian los cuernos a los hombres y no por eso vamos a tener que seguir haciendolo ahora no? NI TRADICION NI CULTURA NI NADA! por cierto!! estoy taaaan contento!! a la mierda belen! que no vuelva por favor!!!

Fina dijo...

A mi no me cae especialmente bien Belen Esteban, pero hoy JJ le ha faltado el respeto, ha sido demasiado borde. Espero que lo que ha dicho Belen de que no vuelve mas a Salvame no se cumpla, porque aunque a mucha gente no le caiga bien, da mucho juego en el programa.

SARIMA dijo...

¡¡HOLA CHIC@S!!
Mis sentimientos esta tarde están encontrados, por un lado estoy "superfelíz" de la espantá de la Esteban y por otro "triste" , porque esto sólo ha sido momentáneo y desgraciadamente para mí y para muchos, mañana , como muy tarde el Lunes volveremos a sufrirla.
No voy a extenderme más con este asunto, aunque queda más que demostrado tanto por mí , como por otras personas que es "personaje non grato".
¡YA ERA HORA QUE JJ LA PARASE UN POQUITO LOS PIES!

Aunque conozco tú respuesta, o sea el silencio , no voy a perder la oprtunidad de preguntarte:
LYDIA, ¿tú la soportas? y si es así ¿qué clase de pastillita te tomas para soportarla?

Cambio radicalmente de tema y te digo que estoy una vez más de acuerdo contigo , cuando has definido a LETICIA como un "clon" de NOOR DE JORDANÍA , esto será debido a que ambas visiten el mismo cirujano plástico. Es cierto que Leticia está muy mona , pero su cara para mí ha perdido personalidad , la prefería antes, yo sólo le hubiera quitado un poquito de cazo y un retoquito de naríz , nada más.

Y como estamos hablando de cirujía , me viene muy bien el tema para opinar de lo poco estético que me parece el torero ENRIQUE PONCE, quiero decirte no logro entender ,cómo lleva ese corte de pelo tan antiguo y todo él se muestra como encorsetado, no sé si me explico, hoy estoy espesa.
Me cuesta comprender , teniendo el glamour en casa ,que no le haya impregando Paloma un poco de su elegancia.
Entonces la elegancia ¿¿se tiene o se adquiere???

¿Qué hago LYDIA toco tema Pantoja o no toco?,creo que sí quieres , en el fondo te "pone"
ja jajaajja jajjaja.....de los nervios jajjajjjj

Bien hoy va a ser facilito , ¿porqué dices que la PANTOJA dice las cuatro letras llena de "CELOS"??
Aquí vuelve a haber una contradicción tuya y de l@s demás compañeros de mesa.
¿No os hartasteis la prensa en genral cuando se lió con este señor, de pregonar que aqui no había AMOR , que era todo interes y que se arrimaba al sol que más calentaba en el momento???
Entonces digo yo:
¿Qué celos puede tener ahora si nunca estuvo enamorada de él?
No sé chica, pero a veces necesitamos hacer una acto de fé para poder creer todo lo que contais , porque si hoy es negro mañana será blanco y así no se puede vivir.
Vamos a ver LYDIA si sentamos las bases de una buena vez .
Si la Pantoja está celosa es que estuvo y está enamorada y si no estuvo enamorada porqué iba a estar celosa.
Esto es de Perogrullo.
No te canso más, perdóname mis ironías , pero te sigo adorando.
Un besito a tod@s

sara dijo...

Yo sobre el tema de Belén de hoy, no me ha gustado que hable por encima de nadie, pero tampoco me ha gustado la bordería que le ha dicho Jorge Javier. Desde mi punto de vista ha estado mal por las dos partes.

Kiko estaba monísimo en las fotos!

Por cisrto Lydia como esta Kiko de la espalda? pues se ha metido un gran porrazo.

Un besazo guapisima!(L)


MAÑANA DOBLEEEEEEEEEEEEEEEEEEETE!

clara2 dijo...

mañana doblee sesiion de SALVAMEE!
k gaanaaas tengoo yaaa! :)
bessitooos lydiaa i a los LOZAISTAAAS

Anónimo dijo...

Mañana en DEC:

Jose Luis Uribarri
Flavia Massoli (ex de Joan Laporta)
José Amedo (ex subcomisario de la policía en tiempos de los GAL)

moniilandiia dijo...

Sestefanya muchísimas gracias,pero a estas alturas ya estas cosas no hacen ni un pequeño rasguño.

Anónimo,tú mismo te delatas,careces de educación.Y sinceramente creo que este no es el blog adecuado para que continuamente toquéis el tema de Belén,tal vez a la bloguera como a todos los cibernautas que pasamos las horas aquí,nos llege a parecer cansino.
Obviamente no tengo ocho años,pero creo que para nada tengo actitud de tal sólo por decirle a lydia lo maravillosa que es.

LYDIA TE QUIERO!

Alicia dijo...

A mi no me parece lógica la reacción que ha tenido esta tarde Belén, Jorge Javier no le ha dicho nada como para que ella se levante y se vaya a su casa.
Sinceramente a mi Belén me hace reir muchas veces, pero a veces tiene actitudes y comportamientos que no me gustan, como por ejemplo interrumpir cada dos por tres o cortar a sus compañeros cuando están contando algo interesante para decir alguna tontería.

Yo también creo que Letizia tiene un parecido razonable a Noor de Jordania, pero a mi me gusta mas Noor que Letizia, creo que tiene un estilazo esa mujer y en la boda de los príncipes para mi fue una de las mejores vestidas.

Bueno, esta noche gala de gh, a ver quién se va!
Yo prefiero que se vaya Arturo.

Besitos.

Vicente_Elche dijo...

Holaa. Hacia tiempo que no entraba. Vaya la que se ha liado hoy, aunque yo ya lo veía venir y me ha gustado lo que ha hecho Jorge. Es que ultimamente las noticias las dejais a medias, siempre os cortan y Belen es una de las que nunca deja hablar a los demás.
Por cierto, que te parece Paz Padilla como presentadora?? jaja yo me rio mucho con ella ^_^ aunque hoy pobre Kiko se ha tenido que hacer mucho daño. Sigo con intencion de juntarme con gente para ir de publico pero viendo que ultimamente sacais a gente del publico a cantar y tal no se yo.. que me da mucha verguenza.

Y lo del tio este que has puesto la notica me parece fatal que se actúe asi, pero que se cree chss.

Muchos besos!!

Anónimo dijo...

que paso al final con belén es que no e vsito el finald e programa allamado o algo??
Esmeralda

libertad dijo...

moniilandiia aburres k matasssssssssssss
los cibernautas hablaremos de lo k nos salga de .........ahí mismo
A PARLA

Anónimo dijo...

Para Lydia y tod@s l@s comentaristas:

¿habéis visto en formulatv.com los motivos por los que mañana va a DEC José Amedo, el de los GAL?

Antonio dijo...

uribarri en DEC?? pues le pondré un poquito los cuernos a sálvame cuando el esté! es un genio de la tv.

Anónimo dijo...

El papá Uribarri hablará del noviazgo de su hija con Darek. Pero contestadme sobre José Amedo y sobre Flavia, la ex de Joan Laporta.

Antonio dijo...

anda!! que uribarri es el padre de la novia de darek?? y solo va a hablar de eso? entonces no lo vere!!

Anónimo dijo...

Antonio, papá Uribarri también hablará de trabajo. Susana fué directora del desaparecido programa musical de TVE "Musica si". Antonio ¿has visto en formula tv lo de josé amedo?

EL CADAVER DE SALVAME dijo...

BELEN ESTEBAN... VAYASE ..USTED, A LA MIERRRRRDAAA... BEEEE QUE ASCO DA ESTA TIA.

paqui dijo...

Voy a ponerme las pilas que he estado un poquitin quitada de enmedio. Quiero decir que no me gusto nada la actitud de belen esteban ayer. un saludo a todos.

FUERA BELEN. dijo...

BELEN SOBRAAAAAAAAAAAAAAAAAAA!!!!
SIEMPRE ES LA QUE CORTAAAAAAAAAAAAAAAAA!!!
QUE POCA EDUCACION TIENE LA TIA!!!!!!!!
SU HIJA TARTAMUDEA POR SU CULPA, NO LE DARA VERGUENZA. MAMARRACHAAA!!!!

ARRIBA BELEN dijo...

SIMPLEMENTE ME ENCANTA BELEN ESTEBAN
ME LO PASO PIPA CON ELLA Y CON SU PERSONALIDAD UNICA!!!!!!
PARTE DE LA AUDIENCIA DE SALVAME SE DEBE A BELEN ESTEBAN

Anónimo dijo...

iran hoy dsifrazados de halloween?? no creo
Rely

Anónimo dijo...

Han cenado ya lydia y techi???

Anónimo dijo...

Me parece muy fuerte el cambio de Jorge Javier hacia Belen.Y no me gusta la actitud de ella que quede claro, pero ese cambio tan radical....
Se habra vendido Jorge Javier a Carmele por la invitación que esta le hizo para asistir con ella a la fiesta a la que asistio la Infanta y " el todo Madrid" a la cual nunca le hubieran invitado???. Ahí dejo la pregunta.
Y para Jorge; QUE BARATO TE VENDES GUUUUUUUUAPOOO!!!

LOLI dijo...

Fuera BELENNNNNNNNNNNNNNNN.
A TRABAJAR COMO TODO EL MUNDO, NO A VIVIR DEL CUENTO.
MENUDA PERLA ESTA HECHA, DESDE QUE DEJO A JESULIN A CUANTOS SE HA PASADO POR LA PIEDRA??
A MI ME REPATEA BELEN, ES IDIOTA, Y PREPOTENTE. CREO QUE A JORGE JAVIER YA LE ESTA CALLENDO GORDISIMAAAAAAAAAAA.
QUE CUIDE MAS DE SU HIJA Y QUE HABLE MENOS DE TODO EL MUNDO QUE ELLA TIENE MUCHO PORQUE CALLAR Y QUE LLEVE A SU HIJA A UN LOGOPEDA.

sara dijo...

Me parece muy fuerte lo falsa que puede llegar a ser Karmele.
Para Karmele siempre siempre siempre es bueno el momento para hacerle daño a Lydia. Pero claro las cosas se le dicen claras a Karmele y todo el mundo es malo y toda pelea es buena para salir a fumar.
Luego dice que si Lydia es falsa, donde le ves la falsedad? Lydia es lo más claro que te pueden echar a la cara es más, ella destaca aparte de por mas cosas POR SU SINCERIDAD!

Que cosa más falsa!

Un besazo Lydia!
Que vales muchooooooo!!!!!!!!!!!!!! Eres muuuuuy GRANDE!
Tequiero.

Pablo dijo...

Hola!!

Como llevo un montón de días sin escribir, lo primero de todo felicitar a Carmen Alcayde por su maternidad y a Jorge Javier por su más que merecido Premio Ondas.

Belén me cae genial y me río mucho con ella, pero ayer creo que no estuvo acertada. Su reacción fue bastante desproporcionada y no debería haberse ido. Es una falta de profesionalidad. Imagino que estará hoy en el "Deluxe" ,así que, a ver qué cuenta.
Tiene muy buena pinta el "Deluxe" de hoy con la Obregón y con Techi. Interesantes entrevistas.

Y ahora, después de ver el "Sálvame diario", creo que ya lo tengo más claro que nunca: estoy muy harto de Karmele. Lo que quiere que los demás hagan es, precisamente, lo que ella no hace: quiere que las rencillas pasadas se queden ahí, en el pasado, y acusa a Lydia de no dejarlas atrás. Bien se lo podía haber aplicado ella en "Tómbola" porque con Mariñas no dejó las rencillas atrás. Por otro lado, dice que está cumpliendo su pacto: mentira. En su página web hay bastantes mensajes en los que ponen verde a Belén Esteban, con lo cual, el pacto no lo está cumpliendo. Por favor, que alguien le saque de la cabeza de una vez lo de ir a Eurovisión: canta fatal y no tiene ningún arte, a pesar de lo que ella se crea. Desde luego, si va a Eurovisión, Chiquilicuatre a su lado era un pedazo de artista. Y, por último, ya está bien de aguantarle sus idas y sus venidas del plató. Cada dos por tres se levanta y se va: claro, como sabe que la van a ir a buscar...Y ahora, que no hace la entrevista...venga ya, por favor, Karmele.

En algo más de dos horas, a disfrutar del "Sálvame Deluxe".
Besos para Lydia y para tod@s!

Anónimo dijo...

k ahh pasado kon karmele k le ah dixo lydia ?? bsss wapa lozanistaaaa a muerte lety tfe

LOLI dijo...

Yo siempre he dicho que Karmele es una hipocrita, convenida y mala amiga. Yo la llamo la "pollo loco" porque esta como una granjaaaaaaaaaaaa. Parece que se quedó en los seis años, porque dice, me he enfadado y me voy, siempre está igual. hoy te junto y hoy no. Mi opinion es que entre Karmele y Belen el programa se va a ir a pique, os guste o no os guste, hay que reconocerlo. Belen tiene un protagonismo algo impresionante, que se cree que va a heredar tele cinco?.
Yo lo que no entiendo es como no le callan la boca ya, porque entre lo que come y por cierto, con la boca abierta (que ascoooo). Y cada vez que alguien habla parece la "voz de la conciencia" uf, es deprimente. Yo creo que alli antes de empezar el progra cuando se juntan las dos, reparten lexatin a chorros. Un saludooo.

paqui dijo...

Hola a tod@s que tal se presenta el fin de semana?
Esta noche salvame deluxe que guayyyy!!!
La actitud de belen no me gusto nada ayer, es de ley decir la verdad, cierto es que belen me cae muy bien pero ayer se pasó, realmente bajo mi punto de vista, jorge javier no le dijo nada malsonante ni fuera de tono para levantarse y largarse. UN besazo.

Alicia dijo...

Me da la risa al oir a Karmele reprocharle a los demás que no dicen las cosas a la cara, que no soporta las puñaladas traperas, que no soporta los falseríos y no sé cuántas cosas más, cuando es ella la experta en hacer todo este tipo de cosas a todos sus compañeros desde hace muchísimos años!

Qué ganas tengo de que empiece el Deluxe!! a ver que se cuenta Anita la fantástica!

Besitosss!!!

Anónimo dijo...

sara que te hace ati pensar que karmele es una falsa?

Anónimo dijo...

Karmele no es tan mala como la pintan

Antonio dijo...

Señores deberiamos de hacer un chat o algo para comentar todos los viernes Salvame Deluxe. Que les parece??

Anónimo dijo...

nada de chats, se comenta todo aqui

Anónimo dijo...

tu, sara enserio contesta, que esque aqui se pueden decir muchas cosas sin tener ni idea. que diga lydia que karmele es una falsa, pues bueno es evidente porque ha trabajado muchisimos años con ella. pero tu que digas eso cuando no conoces a karmele y por tanto no ha podido hacerte nada....

sara dijo...

mira anonimo a mi Karmele no e ha echo anda personalmente pero se dedica a poner a parir a todo el mundo y luego va de buen rollo por ejemplo, otra cosa como ha dicho Lydia pide que se guarden las formas en el plató, y ella las guarda? Que és muy mala compañera que cuando puede le da la puñalada.

Un beso Lydia!!

DiiDii dijo...

Holaaa!!
Lydia tengo que decir que me ha encantado como te has enfrentado hoy a karmele, no la aguanto mucho, la veo muy falsa y que te tira puntaillas pero no te lo dice a la cara, solo lanza cuestiones al aire y haber y que haces.
Me parece genial como la has contestado, se merecia esa respuesta, porque yo si que creo que tu, si tienes algo que decir lo digas a la cara de ella no, pero de ti si que me lo creo.
Es que no se realmente que se cree karmele, un ser superior, que todo lo sabe y que nunca se equivoca, porque tampoco me gusto eso de que algunos de los compañeros de salvame no estuvieran invitados por Karmele, solo unos cuantos, pero no todos.

Tengo una duda, la fiesta que se celebro en esta semana con el personal de salvame, colaboradores, presentador equipo tecnico y demas, porque se hizo? ¿cual fue el motivo?
lo pregunto porque ultimamente no tengo mucho tiempo de ver salvame y lo veo a ratos.

Por otro lado me parece super fuerte lo de este señor, que trate asi de mal a sus empleados...pff... me parece una manera cobarde al maxicmo, porque el echo de que tu sea el jefe y el otro tu empleado no tienes ni porque amenazrle ni nada por el estilo, y menos cuando tu le debes dinero.
Creo que en la sociedad actual, se esta desvariando completamente.

Con la actitud de Belen, yo estoy en parte de acuerdo, porque de cierta manera hasta JJ se despidio de ella diciendole "adios" y "pues vete" asi que yo en este caso estoy de acuerdo con Belen, pero tambien tienes que entender que hay una gente que ha venido a ver el programa y tambien a verte a ti, por lo que no les puedes faltar el respueto asi.

Lydia tu si te encontraras en una situacion similar a la de Belen, ¿te marcharias como hizo ella o aguantarias el tiron como una profesional que eres?


Bueno Lydia decirte que aqui àra todo y que mucho animo ahh y que te queremos y te apoyamos en todo.

Un besito muy fuerte

Anónimo dijo...

hoy Lydia y Mila van wapsimas al salvame delux creo que rosa tambien estara no es seguro pero pude que este
Lucia

Anónimo dijo...

Lucia, estas ahora en T5?? esta pilar eyre??

Anónimo dijo...

pue creo que si yo la e vesto a las 7 rondadon por los platos
lucia

Anónimo dijo...

a vale vale. porque pilar me encanta como periodista.
lucia, eres camara o de produccion, maquillaje...?? estas ahora en T5?? sabes si estara belen esteban??
losiento por hacerte tanta pregunta pero esque me parece un privilegio poder hablar con una trabajadora de esta cadena que no paro de ver en todo el dia jaja

Anónimo dijo...

no te preocupes, pues la verdad de Belén no sabemos nada solo que esta muy cabreada
Lucia

Anónimo dijo...

ya te digo, va a ir el lunes a G-20 y todo!! jajaja!!!!! igual aparece esta noche y todo!!que suerte tienes de trabajar en la telee madre mia. haber si yo dentro de unos años puedoooo! seria mmi sueño poder entrar. tu como lo conseguiste?

Anónimo dijo...

pues mucho estudiar y en pece con radio y luego en telecinco pero trabaje ante de todo como camarera cudadora de niños y luego todo lo que ya tengo , bueno tedejo que me esta llamado
Lucia

Anónimo dijo...

anda ya trabajar en telecino es una meirda yo trabajo en antena tres
Maca

clara2 dijo...

pero pk se cabreo ayer beleeen? es k
no pude ver Salvameee :)
bessitoos

Rocío dijo...

Clara, se cabreo porque estaba hablando karmele y ella hablaba por encima, entonces, dijo jorge javier como que esperaba a que karmele acabara o que se fuera y dijo: pues me voy. Y si fue pero se fue que no volvió. Un besito

Anónimo dijo...

Lydia sale en dec

Anónimo dijo...

Cuando a cntado lydia lo de ana que estaba en un coche con uno y ha dicho algo belén de charly, que ha dicho??? Y que ha dicho también de tombola??

moniilandiia dijo...

En el mundo del periodismo es muy dificil tener amigos que se dediquen a lo mismo que tú,sólo por tener distintas opiniones y cosas así y la verdad si aún sólo con eso es díficil se amiga de Karmele es más díficil aún.
Para mí es una mujer siniestra,no se sabe lo que quiere ni como va a reaccionar.
Me encantó Ana Obregón,como actriz,desde mi punto de vista,pésima,como persona,encantadora.ç
En DEC están hablando de los periodistas a los que casi le quitan su carrera por problemas judiciales relacionados por temas que tocan,aparte de encontrarse colaboradores de la talla de María Patiño,Jesús Mariñas,Javierr Sardá,ángela Portero...también se encuentra Lydia Lozano.
Un besito a todos!
Lydia te quiero!

Antonio dijo...

alguien que haya estado viendo DEC que nos informe de qué han dicho de lydia por favor...!!!

sara dijo...

Bueno del Sálvame Deluxe de esta noche, sin duda alguna la mejor entrevista ha sido la de Ana Obregón con diferencia.
Ha estado genial.

A mi Karmele no me gusta nada de nada.

Y Techi esque se ha reido de todo el mundo, para hacer lo que ha echo ella vamos quien sea.
Encima me ha parecido fatal que cuando a entrado Carolina le diga hola y se vaya, osea tia no hagas el papelón y te vas antes de que entre, que la opción te la han dado. Por supuesto y sin ninguna duda me ha gustado muchísimo más Carolina que Techi.
Lo de la semana santa también pienso que es una falta de respeto, que se esten dando el lote ahí delante, y són cosas que me rebientan.

Un besazo grande LYDIA!

Alicia dijo...

Que ese productor que es tan GUAPO en el año 2004 quiso investigar a una serie de periodistas, entre ellos Lydia.
Nada nuevo,porque ya leí algo sobre esto hace años.

La entrevista de Ana Obregón genial, ha estado encantadora.
Me han encantado las botazas que llevaba,ideales!
y el vestido igual!
Techi no me ha parecido sincera.

Un beso.

Laura Izaguirre dijo...

Cuándo lo repetían?? Me quedé dormida, quiero ver la entrevista de Karmele... Por internet estará yaaaa???

Un beso a todos =)

Antonio dijo...

Antena 3
- "DEC: José Luis Uribarri”: 19.7% y 2.251.000

Cuatro
- “Supernanny”: 10.1% y 1.607.000
- “Callejeros: Hotel”: 11.2% y 1.848.000
- “21 días de lujo”: 15.1% y 1.977.000

La 1
- Cine: “Una pandilla de pelotas”: 9.5% y 1.500.000

Telecinco
- “Sálvame Deluxe: Ana Obregón”: 12.9% y 1.506.000

SE CONFIRMA ALGO QUE YA DIJERON EN SALVAME DIARIO: ANITA OBREGON YA NO INTERESA! Una pena la verdad porque me gusto mucho su entrevista. La de Techi absolutamente cansina. Carolina estuvo muy bien (y es guapisima por cierto xD) y karmele en su linea, aunque quizas un poco menos divertida que otras veces.

Anónimo dijo...

Anoche, Cantizano tuvo un 19,7% de share y 2.251.000 espectadores, el deluxe tuvo un 12,9% de share y 1.506.000 espectadores y el reportaje de Carmen Lomana en Cuatroº tuvo un 15,1% de share y 1.977.000 espectadores.

Anónimo dijo...

Antonio, pido perdon por que hemos puesto dos veces los datos de audiencia.

Antonio dijo...

jaja no pasa nada!!

Antonio dijo...

por cierto!!!! anita obregon no es tan buena actriz! se le noto un monton que tenia pactado con saul que éste, en un momento de la entrevista, sacara lo de la denuncia y lo del tema beckham. para mi estuvo muy bien hasta ese momento.

Anónimo dijo...

En Galicia, "Luar" con Gayoso y Silvia Jato tuvo un 21,1% de share y 194.000 espectadores.

Anónimo dijo...

Laura Ponte, con el ex de Lydia Bosch (ultima noticias)
Lucia

LAura MT. dijo...

Porqué te llevas tan mal con Karmele Lydia??? Es porque no te apoyo lo suficiente cuando lo pasaste mal por el tema ylenia o viene ya de atrás?? Es que no entiendo como ospodeis llevar tan mal , depues de haber trabajado tantos años juntas.... siempre váis a la par , si estás tu, está Karmele: Tómbola , TNT , A Tu Lado , Sálvame......

MUA.

Anónimo dijo...

No creo que la baja audiencia sea sólo por los personajes, también se debe a los ¿periodistas? que formaron parte del plantel.
No se puede estar criticando a Ana Obregón por el simple hecho de que respire y luego, cuando la tienes frente a ti, reculamos todos a una y donde dije digo, ahora digo Diego porque sí y me sale del alma.
El público no es tonto, no nos gusta que nos traten como tal y mucho menos nos vendan la moto cuándo y cómo a ellos les interesa.
Mila anoche repetia un discurso que ya le he oido más de una vez con otros personajes de los que con anterioridad, ha dicho auntenticas burradas; "esta noche estoy descubriendo de verdad a Ana Obregón, esta noche estoy soprendida porque veo que estaba equivocada..." Anda Mila, que ya huele...
Después con la novia o ex novia de Kiko Rivera. A la fuerza querian sacar declaraciones que a esta chica, no le daba la gana de inventarse. Querian hacer ver nuevamente un lado oscuro y tétrico de Isabel Pantoja y su familia que por más que insistian , la chica no reconocia ni decia haber vivido. Cuando contaba que en casa de Isabel todo es más normal de lo que la gente piensa, es como si a todos les diera un infarto colectivo.
Mila se retorcia en su silla como si le estuvieran dando descargas eléctricas continuamente.
Claro está, como la chica no entró en el juego de despropósitos y calumnias que se pretendia vender de nuevo, fue despedida entre pitos y abucheos generalizados. Bien merecido se lo tiene por otra parte, deberia haber pensado un poco más donde se estaba mentiendo.
Si algo se pudo salvar, fue la entrevista de Karmele. A mi particularmente me sorprendió más de una cosa de las que contó.
No entiendo como Karmele sigue en ese programa sin ningún tipo de lógica, coherencia y seriedad.

Anónimo dijo...

Hola a todos!!
Desde que empezó el programa "Salvame diario" tengo que decir que he sido una fiel asidua de sus tardes. Sin embargo, aquello que roza el éxito se descuida y se malogra cuando hay quien piensa que una vez en la cima, es imposible fracasar. A mi particularmente hay acciones y hechos dentro de este programa que rozan lo insólito, lo sorprenderte y lo inaudito, llegando a sentir vergüenza ajena.
Cuando se estrenó 'SALVAME DELUXE', todos, todos, todos, todos, todos los lunes Jorge Javier Vázquez se jactaba de ser el más popular del cementerio por haber sido líderes... Pero hay un refrán muy sabio que dice que no todo el mal y no todo el bien dura siempre... Creo que a este presentador ante las formas y ante la cámara y su público el falta humildad. La tarde en que le dieron el Ondas, hasta una servidora se emmocionó aquella tarde con un Jorge Javier a su misma vez emocionado, pero que luego desvirtuó con ese afán de recordatorio pesadísimo y cansino, por haber obtenido el premio.
Creo que todos, con sus riñas personales, sus diferencias, su afán de protagonismo están rompiendo la magia de lo que fue Sálvame en sus mejores tiempos. Las continuas salidas de tono, el abandono constante de los colaboradores en plató, la ridiculez de Karmele con sus insistencia permanente de querer ir a Eurovision (Por favor que alguien le de la medicación), el papel co-protagónico de Belén Esteban que se ha subido por la parra con la excusa de que el pueblo la quiere, y ahora sólo es una mosca cojonera agotadora con sus permanentes 'bromitas' y comentarios que siempre quedan fuera de lugar. Y que por supuesto, si un colaborador abandona el programa a mi como espectadora no me interesa ver los pasillos de telecinco, ni perder 30 mnutos en hacer que un colaborador vuelva al programa. Ya no hay contenido, no se sabe donde comienza y donde termina, no hay exclusivas sin que nadie respete sin interrumpir, no hay un límite entre la naturalidad y la profesionalidad....
Desde aquí, como fiel espectadora pido por favor que alguien reconsidere el formato del programa, y que por favor ya que hacemos una elección de ocio de nuestro tiempo libre, que no nos tomen el pelo con chorradas.

Añado también que gracias a este programa te he visto Lydia como nunca, eres una gran profesional, divertida, y un gran descubrimiento, junto con Mila Ximenez. Sois lo mejor del programa, con diferencia.

Un abrazo muy fuerte,

VERONICA

Anónimo dijo...

Alguien me puede contar si aeyr en el deluxe paso algo con lydia y karmele¿?¿?¿ volvieron a discutir como por la tarde en el diario¿??
por favor contestarme que no pude ver la entrevista que me dormi. bssssss

moniilandiia dijo...

Techi,desde mi punto de vista lo único interesante fue la afirmación de la perdida del bebé al que esperaba.
Me pareció una entrevista un poco aburrida,ya que no destacó nada que no supieramos del hijo de Isabel.Creo que a Lydia le contó muchísimas más cosas en esa cena íntima.

Cada vez la competencia es más dura,no me refiero a que Dec tenga mejores invitados,pero la gente unos viernes se decanta por sálvame otro por dec...

Anónimo dijo...

No pasó nada por la noche con Lydia y Karmele.. de hecho Lydia no le hizo más que una pregunta en toda la entrevista... No discutieron porque practicamnte ni hablaron! un Saludo , ,,,

Anónimo dijo...

ombre monica pero tienes que tener en cuenta que salvame deluxe lo ve la gente por los invitados que v an cuando los invitados no gustan la gente se va a DEC y si tampoco gustan se ponen un DVD no se como decirte....
la gente no es tonta y no por que sea salvame hay que aguantar a los falsos de lo sinvitados que van algunas veces y con DEC digo completamente lo mismo eeeh..

Antonio dijo...

el ultimo Anonimo tiene razon! no porque sea Salvame tenemos que tragarnos el toston de Techi o el de Jose Campos hace dos semanas. Es cierto que nos hacen reir y demas por las tardes, pero llevan a cada invitado por la noche... que es completamente infumable.

moniilandiia dijo...

anónimo estoy muy de acuerdo contigo.
Pero yo lo veo para haber si dice más,a lo mejor en el momento que me pongo a ver una pelicula es el momento en que dice algo clave.
Pero te entiendo perfectamente.
La entrevista de Karmele no me gustó nada,sólo ponían videos y apenas duró unos pocos minutos.

montsee dijo...

Hola a todos! Moniilandia estoy totalmente de acuerdo contigo y tambien con el anónimo y Antonio.
Mucha gente ve Sálvame Diario porque hacen reir y eso. Pero en el deluxe, la cosa cambia a veces. El deluxe pienso que es bastante parecido a DEC, en el sentido de las entrevistas. Entonces, como cita el anónimo, la gente si ve que no le interesa la persona que estan entrevistando en Sálvame cambia de cadena para ver si en la otra hay algun invitado más de su agrado. Y sino opta por la opción de ver un DVD.

Yo estaba casi segura de que el deluxe con Ana Obregón iba a ganar a DEC, sin ninguna duda.
Al ver hoy las audiencias me han dejado sin palabras.. No me lo esperaba para nada...

Pienso que la entrevista a Ana estuvo muy bien, y que por lo tanto pensé que tendría más espectadores. La de Techi, en general me aburrió bastante, porque contó muy poco en comparación de lo que supongo que le explicó a Lydia en esa cena. Y la entrevista a Karmele, demasiado corta. Por falta de tiempo, no le preguntaron casi nada. Creo que esa entrvista podría haber dado mucho juego..

Besos a todoss!

Te quiero demasiado Lydia!
montsee

Antonio dijo...

Deberian aplicar la formula de por la tarde, que tan buenos resultados les da. Por la noche parecen todos unos señoritos de la calle Serrano y por la tarde unos "desarrapados" (en boca de Jorge Javier). Han querido copiar a DEC por la noche y no siempre les sale bien.
La gente lo que quiere es reirse y, a no ser que lleven a Paz Padilla o Marivi Bilbao, en el deluxe hay poca gracia y demasiado formalismo.

Anónimo dijo...

JODER LA DE TECHI ABURRIDAAAA?? AMI ME ENCANTO CON JIMMYYY!! ENSERIOOOO!! QUE BUENO ES ESE TIIOO, TIENE CADA GOLPE...!!
AUNQUE HAY VECES QUE SE PASA, COMO LO HIZO CON LYDIA PERO BUENO ESO SON MOMENTOS QUE LE DAN. PERO QUE BUENOOOOO!!!
ME FIJE Y EN UNA DE ESTAS QUE DIJO,
LYDIA AGACHO LA CABEZA PARA REIRSE PROQUE ESQUE ES DEMASIADO

sara dijo...

A mi siento decir que Jimmy no me gusta nada, y en su momento que pasó aquello con Pipi Estrada lo defendí, pues esta se pasó mucho con Jimmy.

Y Techi me aburrió muchísimo, para lo que dijo se podría haber quedado en su casa.

Lydia un besazo, tequiero(L)

moniilandiia dijo...

Jimmy es una persona super mal hablada,hasta un día que no sepas si te quiere deci una cosa buena o mala,y tal vez la buena te la diga de malas maneras.
Siempre habla con la gente y no para de decir tacos...
no sé,no me gusta sinceramente.

Anónimo dijo...

Por fin hay personas objetivas en este mundo. Como porejemplo sarima, clara, rocío, diana... Ellas opinan sin tener en cuenta la previa opinión de lydia!! Sara mónica, hay que ser así, si alguna quiere ser periodista tiene que saber que cuando se trabaja no se tiene amigos, eres tu sola.

Que os parece que pongamos a prueba a lydia?? En buen sentido. Quiero saber si realmente lydia lee todos nuestros comentarios y para ello,
LYDIA, si lees este comentario que es como uno más di: SIIIII!!
Si por el contrario lydia no nos lee no contestara nada.

Un beso

moniilandiia dijo...

el último anónimo...
sobre tu opinión como comentarista la respeto pero obviamente no la comparto para nada.
Y sobre lo de poner a prueba a lydia...no lo veo nada justo ya que es normal que ella no pueda leer todos los comentarios debido a su ajetreada vida.Quieres hundir a Lydia y no sabes ni como!
Lydia que lea los que pueda,no los tiene que leer todos por obligación,nosotros somos sus fns y obviamente es mucho más importante su familia y no va aestar aquí una hora leyendo 167 comentarios y más con la vida que lleva.

TE QUIERO LYDIA!
Mónica

Antonio dijo...

Mónica, con todos mis respetos, empiezo a sospechar que eres la desaparecida Chatina. Escribes igual que ella y le haces la pelota a Lydia de la misma forma.

Maríaa dijo...

Pienso lo mismo que tu monica,es imposible que ella que esta para arriba y para abajo todo el dia,tenga tiempo para leer todos y cada uno de los mensajes.

La entrevista de Ana obregon me gustó,pensaba que iba a ser muy aburrida,pero ami personalemnte me parecio un poco divertida.

Karmele...aiiii karmele..
ella las deja caer..las tira..y cada uno que las coja por donde pueda pensara ella.y asi hizo lydia la otra tarde,la cogió por donde le venia,hablastes muy bien lydia,ya no es cuestion de sinceridad,bueno de la sinceridad de karmele si esa qu eno tiene!,siempre habla como con ironia,es un poco sarcastica.

un beso a todos,un abrazo para ti Lydia!

Mariaa dijo...

ups perodn pense que lo de los sms lo habias puesto tu,me referia al anoniom

Iria Fernández dijo...

Vaya, pues esperemos que todo se solucione en el mejor sitio para estas cosas, que es en los juzgados.

Lydia, hacía mucho tiempo que no pasaba por aquí, decirte que te sigo viendo cuando puedo y que me encantas, y a los demás comentaristas de este blog muchos saludos a todos, ah, y os dejo el link de mi nuevo blog por si a alguien le interesa echar un vistazo, la primera entrada habla de Mayra Gómez Kemp. Podeis opinar aquí:

http://analizandomiradas.blogspot.com/
http://analizandomiradas.blogspot.com/
http://analizandomiradas.blogspot.com/


Muchas gracias y un saludo a tod@s.

moniilandiia dijo...

Por el tema de chatina no me voya volver a mencionar al respecto,ya que bastantes veces he hablado del tema y he dado mi más sincera versión llamada:ralidad.
De peloteo nada,porque me parece sumamente caradura que se atrevan a comentar en un blog de alguien y quieran desafiar a Lydia de esa manera.

paqui dijo...

Creo que tendrian que tener más cuidado con la gente que llevan al programa, llega un momento que la gente se aburre y cambia de canal. Mi impresión y si me equivoco, me rectificais, siento ser tan clara, mi opinión es que Jorge Javier está muy harto del programa. Creo que le queda muy poco para saltar de ahí, y cuando él se vaya, esto va a ser una "merienda de negros". No creo que el que entre tenga la misma paciencia que él. Un saludo para toda la gente que entra aqui. Y siento si no estais de acuerdo conmigo.

Rocio dijo...

Holaa!!
Lydia, me gustaria hacerte una pregunta:
hace unas semanas como dije, estuve pasando el puente en Madrid. El ultimo dia, mientras esperaba en la estación de Atocha me encontré con María Patiño. Ella estaba con su hijo, pero al encontré bastante "sola" es decir, que nadie se acercaba ya no digo a pedirle autógrafos si no simplemente saludarla o algo asi, como ocurriria si estuviera cualquier otra famosa.
entonces mi pregunta es la siguiente:
¿como os cae, a los periodistas y colaboradores de este medio María Patiño? ¿pensais que es buena en su trabajo o todo lo contrario?


Un besito!

Antonio dijo...

Monica no lo dije para enfadarte. Solo que me resulta raro que tienen la misma forma de halagar a lydia, que mas que halagar yo diria babear. Pero si tu dices que no eres la desaparecida Chatina yo te creo. Lo siento

Y que conste que lo digo con mi nick, no como otros que insultan y simplemente ponen Anónimo. Tengan narices y pongan su nombre!

moniilandiia dijo...

Antonio,esque lo de Chatina ya son tres cuartos de lo mismo igual que siempre y sobre ese tema si que no me volveré a mencionar más.

Anónimo dijo...

monica pues si dices que no vas a habalr del tema pues ya no escribas ningun comentario mas, como te gsta yamar la atencion tia

Antonio dijo...

Lo siento mucho Monica de verdad, no quiero que haya mal rollo entre los que comentamos en este blog. Un saludo.

Miska dijo...

Hola a todos!
Lydia lleva bastante tiempo sin escribir, no? Bueno, no pasa nada, ya lo hará.
El viernes no pude ver el Deluxe, así que no me he enterado, pero he leído algunos comentarios vuestros en relación a la discusión entre Lydia y Karmele, sobre que en el Deluxe no se dirigieron la palabra. La segunda siempre ha sido una persona con una lengua bastante viperina, o no recordamos lo que ocurrió en su entrevista hace muchos años a Carmen Sevilla? Últimamente está que se pelea con todo el mundo, no lo entiendo. Y, sin lugar a dudas, me parece una tremenda falta de respeto lo que hace de abandonar el plató constantemente, sobre todo hacia España y hacia los colaboradores. Aun así, debo reconocer, que lo que le haya hecho a Lydia, no lo sé. Sin lugar a dudas, ella sabe lo que dice.
Aunque no viera el programa, creo que Ana Obregón ya está pasada de moda, tuvo su época, pero desde luego, no es ésta. Lo que ahora interesa son temas como los relacionados con Escassi, Julio Iglesias (hijo), o personajes de actualidad, como Techi.
Por cierto, ya Lydia cenó con ella no? Supongo que ya nos contará. Besossssss :)

Anónimo dijo...

miska que paso con carmen sevilla?

Anónimo dijo...

se quejara lydai de coments, no hay ninguno hoy casi eeeehh? si mirais en el confe de kiko...

ANONIMO dijo...

MONILANDIA... ABURRES QUE TE CAGAS... Y LA B.E. DA UN ASCO QUE YA HUELE, QUE LA MANDEN HA FREIR MONAS Y HA CUIDAR Y EDUCAR A SU TAN VENDIDA HIJA.

CARLUCHII dijo...

os planteo uan pregunta para los que comentais amenudo aqui y porsupuesto para lydia:
CREEIS QUE EL QUE VAYA BELEN ESTEBAN A G-20 MAÑANA LO HARA POR VENGAZAA? POR LA BRONCA QUE TUVO CON EL GANADOR DEL PREMIO ONDAS AL MEJOR PRESENTDOR? jajajajaja

Jenny.M dijo...

Carluchii:
lo de que Belén valla a G-20 ya lo tenía pensado ella, pues en un Sálvame Diario Risto se lo preguntó en directo.
Pero bueno que igual hay algo de venganza no te digo que no jajajajaja.

Lydia!! me pareció muy bien que te enfrentarás a Karmele, no se que pasó en realidad, pero por lo que pude oir, ( y corrígeme si me equivoco ), ella se dedica a hablar de sus compañeros a las espaldas.?
Sinceramente, QUE FALSA!!
jeje
Un besazo enorme a tod@s!!
Y uno más grande,de todo corazón para ti Lydia!!

sara dijo...

Al anónimo que dice que hay que comentar sin tener en cuenta la opinión de Lydia, decir que yo no comento segun lo que opine ella sino que comento en lo que yo opino realmente.

Un beso Lydiaaa(L)

Chatina dijo...

Buenas noches a tod@s:
Como mi propio nick dice: Soy Chatina, y a mucha honra. Y no tengo que ver absolutamente NADA DE NADA, con moniilandiia. No estoy desaparecida, lo que pasa es, lo siguiente: Que soy una persona que no acostumbro a faltar al respeto a l@s demás, cosa muy diferente a lo algun@s de vosotr@s hacéis cuando entráis aquí (además, muy a menudo). Y segundo: ¿Por qué, a veces, ni siquiera entro? la respuesta es tan fácil como esta: No entro, porque no tengo necesidad de leer ciertos comentarios tan absurdos, como absurd@s sois much@s de vosotr@s.
Y lo siento por Lydia Lozano, pero, prefiero desconectar e ignorar ciertos comentarios que no tienen ni pìes, ni cabeza.
Aunque he de decirte, Lydia: Que de vez en cuando, paso por si has dejado algún comentario. O por si hay algún comentario coherente, porque también he de decir, que hay personas que escribís aquí, que sois maravillos@s.
Muchos besos, Lydia y un fuerte abrazo, guapísima.
Que me lo paso genial, cuando bailas los tonos, en Sálvame". Que arte tienes,jeje.
Chao a tod@s.

Antonio dijo...

Te pido disculpas si te molesté Chatina. No lo hice con esa intención de verdad!

Miska dijo...

Hola!! Pues, anónimo, lo que ocurrió fue que en un programa, el cual no recuerdo el nombre, Karmele comenzó a decir que Carmen Sevilla tenía un lado oscuro, que en realidad era una mala persona, para dejarla por los suelos, pero Carmen fue lista y le dijo que era una mala periodista, cuando Karmele se puso a llorar, y si mal no recuerdo, se fue del plató, cómo no!! Esto es de lo que me acuerdo básicamente, puede que no ocurriera exactamente así, pero más o menos. Creo que en YouTube puedes encontrar vídeos. Lo que sé es que me impacto mucho aquello. Besos

LYDIA LOZANO dijo...

Bueno cuantas cosas tengo que comentaros.Primero, me remito a LA exclusiva, que me dice que vaya periodismo que hago. Cuando ISabel se fue a Rusia con Chelo Garcia Cortés, si vinieron con un reportaje debajo del brazo, pero como no comentaba nada interesante no se publicó. Pero, eso es lo que tiene cobrar por un pack, que no siempre hay noticia; pero, ahora que ha echado a Julián de la pera, seguro que veremos pronto otra entrevista en Hola.
Segundo con respecto a Karmele, sólo voy a decir, que cómo compañera me comporto en el plató en maquilaje y peluqueria; y así lo demostré en su entrevista, que le hice correctamente tres preguntas. Lo que pienso de ella me lo guardo para mí porque no quiero que este blog se convierta en algo que he criticado siempre de su pagina web. Tercero, hemos perdido en más de una ocasión con DEC y cuando ganamos los lunes lo dice con mucho orgullo JJ, normal; llevamos crei que ocho programas sólo y DEC casi siete años. Es normal que nos ha ilusión, nada más. La audiencia se la llevó cuatro, porque con el viaje que hicieron a Paris con Carmen Lomana arrasó. A mí particulartmente, me pareció interesantísimo el testimonio de la ex novia de Pepe Navarro en DEC y el tema de que nos había investigado FRade; algo que supe en su momento, pero nunca comenté porque no podía demostrarlo; por lo tanto estoy muy contenta. Y, por último, la Techi que conocí tomando algo, no fue la que estaba en el plató ACONSEJADA por María Navarro, es decir, estaba cortada y con el miedo en el cuerpo. Qué miedo tendrán en casa de la Panto a qué puedan contar sus ex novias???? Eso es lo que me gustaría que me contasen.Besos para todos los que se pasean por aquí y mil grcias!!!!!

Anónimo dijo...

ola hoy estaran Lydia ,kiko son los dos que vi pero me han dicho que tambien han visto a rosa y mila peor no se yo solo vi entra a ellos dos
Lucia

Chatina dijo...

Buenos día a tod@s:
Antonio, permíeteme decirte: Que no acepto tus disculpas. Primero cuando digas algo, piensa antes de decirlo. Porque, en primer lugar: Yo no escribo como Mónica. De echo algunas de las cosas que ella ha escrito en este blog; yo jamás las escribiría (ya que lo considero faltas de respeto, hacia algunas personas). Y no tengo por qué dar ningún tipo de explicaciones, de a que me refiero. Pero ni a tí, ni a Mónica, ni a nadie.
Y en segundo lugar y que te quede muy clarito: Yo, en nigún momento he hecho la perlota a Lydia, pero ni a Lydia, ni a nadie. Porque eso, no va con mi forma de ser. Simplemente digo lo que pienso, y punto. Si una persona me cae bien, me cae bien. Y si por el contrario, una persona me cae mal, lo digo igualmente. Eso no se llama hacer la pelota. Eso se llama, decir un@, lo que pinsa realmente.
Y no tengo nada más que decir al respecto.
Un saludo.

Y un fuerte abrazo, para tí, Lydia.

Chao a tod@s.

SARIMA dijo...

HOLA LYDIA
Me gustaría comentarte brevemente (jajajajajajj) algo del Sálvame Deluxe, que dicho sea de paso no seguí con interés.
Ana G Obregón, la mujer que pasará a la historia por haber conservado durante toda su vida una infantil forma de vestir y una mente y comportamiento de una quinceañera, ¡¡es patética!! sin más comentarios.
Sólo añado que el "mamoneo" con el que algunos la entrevistaron y el "babeo" de algunos "profesionales",(SAúl Ortiz) me pareció totalmente fuera de lugar , cuando en multitud de ocasiones no dudais en ponerla en su sitio, y muy merecidamente ¡ah! y de buena actriz ja ja
ja .¡ NO LA SOPORTO ES UNA RELIQUIA DEL PASADO!

Daré un salto en el orden de apariciones y hablaré de la entrevista a Karmele , me pareció corta y desaprovechada , pues su vida y su carrera es lo suficientemente larga e interesante como para despacharla en cinco minutos. Mi admiración por su trabajo a lo largo de su vida es total , ahora bien, cómo periodista en el mundo del famoseo ha ido dejando algún cadaver que otro.

Y ahora viene el plato fuerte y que más me apetece comentar. TECHI.
Esta chica llegó sin ningún guión aprendido , y sin demasiadas tablas en un plató.
Volveré a ser muy sincera , aunque por ello reciba todo tipo de críticas, pero la entrevista me pareció una encerrona ,cómo muchas que hemos visto los expectadores, realmente.... ¿qué era una entrevisa sobre TECHI Y kIKO? , o el único propósito que tenia el programa es sacarle información sobre Isabel Pantoja y así seguir proyectando en el tiempo una vez más , lo mala , lo perversa , lo inhumana , lo mala madre , etc etc....que decís que es esta señora.
A veces me pregunto , si para intentar derribar a una persona que por encima de todo ha trabajado duramente toda su vida , con su arte y con su voz, bien ,¿para esto habeis estudiado unos años en la universidad?, no lo entiendo.
Y sus cuentas con la Justicia , no os preocupeis , si tiene que pagar pagará , no convirtais los platós en tribunales.

Como consecuencia de la escasa información que aportó , llegó la decepción con ella, y la sometieron a un pequeño linchamiento a modo de despedida , en el que quedó suficientemente claro que su entrevista personal no interesaba lo más mínimo , las garras de Mila Ximenez estaban afiladas para , a traves de Techi, hurgar en las entrañas de Isabel P, pero la jugada le salió mal.
VAYA OBSESIÓN ENFERMIZA QUE TIENE MILA CON ISABEL

Por cierto interesante la entrevista de la ex de PEPE NAVARRO, otro que está por encima del bien y del mal, ¡¡lo que es tener un buen respaldo!! y sentir que tus influencias pueden llegar a tapar todas las fechorías que este ser humano es capaz de hacer, ¡ojalá le vayan quitando la careta!.
Cómo tambien se la deberían quitar al señor Frade y así dejar al descubierto , la forma mafiosa que utilizan algunos para conseguir sus propósitos.
La sensación que tengo como expectadora es que las teles por dentro , en general, funcionan como la propia mafia siciliana ,donde existen vendettas, trapicheos y ajustes d cuentas por doquier.

Bueno , me despido con la esperanza de que me quieras entender y que nunca , mi intención es faltarte el respeto que te tengo, sino, no perdería mi tiempo en hacer estos comentarios, gracias por ello y mi cariño siempre.

Saludos a tod@s.

Laura Izaguirre dijo...

Jolines, cada vez que entro y veo los comentarios de Sarima, me quedo alucinada, son increíbles, de verdad, te lo curras mucho, enhorabuena ;)

Espero que estéis todos bien, Lydia guapísima, un beso enorme :)

A EL CADAVER DE LA TELE dijo...

hola guapos, MI PESAME a la drogadicta , vendehijas, manipulamaridos, maltratadora de ex, y acosadora de esposa de ex, por el fracaso de el G20, de esta noche, ni se le ocurra que la audiencia va ha ver a este esperpento de mujer, en ligar de ver a su inolvidable amor de su vida como es JESULIN, que le compre una escoba y se vaya ha barrer el desierto ja,ja,ja,ja,.... INUTIL Y DESGRACIADA.

MARIONA dijo...

CADA VEZ HAY MENOS AUDIENCIA EN SALVAME , Y EL MOTIVO ES LA BEEEEE..., QUE YA NADIE LE AGUANTA, Y CADA VEZ NOS CAE MEJOR LA CAMPA Y SU MARIDO, PORQUE EN UN FUTURO JESULIN SERA EL MARIDO DE LA CAMPANARIO, O SI NO AL TIEMPO, BELEN ESTEBAN VAYASE USTED A LA MIERDAAAA... YA ME HAGO ECO DE ALGO QUE HE LEIDO POR AQUI.

Antonio dijo...

TOMA BOMBAZOOOOOOOOOOO!!!!! BELEN ESTEBAN VA A DAR LAS CAMPANADAS!!!!!!!!!! no entiendo como se les ha ido tanto la olla a los de telecinco con esta mujer.

Antonio dijo...

pues yo tambien voy a ser sincero hoy y si tu dices que cuando te cae mal alguien lo dices, pues yo tambien: Chatina eres la tia mas pelota y plúmbea que jamas he leido. Te pedi perdon desde la corrección pero ahora solo puedo decir que te den! :D

Antonio dijo...

pues ojala que esta noche el G-20 tenga un gran dato! para que risto se empeñe en contratarla en su programa y nos la quiten de salvame!!!!

ANDREITA ESTA TRISTE dijo...

SOY UNA MAMA DEL COLEGIO DE ANDREITA QUE A VECES HE COMENTADO EN ESTE BLOG, ES VERDAD QUE LA NIÑA TARTAMUDEA Y ESO LE ACOMPLEJA AL MISMO TIEMPO QUE SUS KILOS DE MAS, YA QUE DICE QUE ESTA GORDA , T TODO ESO UNIDO A LA MADRE QUE TIENE TAN IGNORANTE E INCULTA ESTA LLEVANDO A LA NIÑA A UNA POSIBLE DEPRESION .

EL COÑAZO MONILANDIA dijo...

CHATIMONILANDIA CALLATE DE UNA VEZ QUE ABURRES A LOS MUERTOS.

Publicar un comentario

ATENCIÓN: Todos los comentarios serán publicados siempre y cuando se escriban con moderación y respeto. Al más mínimo insulto, la administración del blog procederá a la eliminación del mensaje.

Para dejar tu comentario simplemente escribe el mensaje en el recuadro blanco. Luego pincha donde pone "Seleccionar perfil" y escoge NOMBRE/URL. Escribe tu nombre y deja, si quieres, la URL en blanco. Haz click en "Publicar un comentario".

Al superar los 200 comentarios, los siguientes aparecerán en otra página.
Para ver del 201 en adelante, solamente hay que pinchar en "más reciente" (link situado justo encima del primer comentario, en la esquinita de la derecha) y automaticamente os llevará a la siguiente página.

 
© Mari. 5 de Mayo 2009 | Blog Oficial de Lydia Lozano. ¿Y por qué? | Contacto: bloglydia@hotmail.com | Twitter del Blog: twitter.com/BlogLydiaLozano